The portion of the mRNA sequence that is translated into a polypeptide chain is: a) the...
Homework Answers
a) the coding sequence
The coding sequence in a mRNA is flanked by the five prime untranslated region (5'-UTR) and the three prime untranslated region (3'-UTR). The CDS is that portion of an mRNA transcript that is translated by a ribosome.
-- 5'UTR appear before Initiation Codon and 3'UTR appear after Termination Codon so they not translated, so they are the 'Untranslated Regions' of mRNA,
-- Introns are Spliced out of heteronuclear mRNA during RNA Splicing, so they are also not the part of translation.
-- Exons are nucleotide sequences within a gene, which go on to be covalently bonded to one another in order to create mature mRNA. Exons contain both protein-coding (translated) and non-coding (untranslated) sequences so complete exons are not translated.
Add Answer to:
The
portion of the mRNA sequence that is translated into a polypeptide
chain is:
a) the...
a) Why was it important to sequence ESTs as well as the human genome? A. Because...
a) Why was it important to sequence ESTs as well as the human genome? A. Because ESTs contain sequence that is not in the genome B. To identify the location of the exons C. To identify the location of the promoter D. Because ESTs are different than what is in the human genome b) What regions of the genome are missing if only ESTs are sequenced? A. cDNA B. Exons C. mRNA D. 3'UTR E. Introns c) Name a region...
estion 22 Which of the following elements will be translated by the ribosome? ot yet nswered...
estion 22 Which of the following elements will be translated by the ribosome? ot yet nswered Select one: O a. Promoter Marked out of 1.00 b. 5 UTR Flag question c. Exons d. Introns
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT...
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT involve: A. Excision of non-coding sequences (introns). B. Addition of the 7-methylguanosine cap at the 5'-end. C. Charging of an amino acid residue to the CCA-end. D. Joining of coding sequences (exons). E. Attachment of a long poly(A) sequence at the 3'-end.
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
moose the correct alphabet (letter, noting that each and may have only ch answer can be...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons...
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons (shown in solid colors). The 5' UTR and 3' UTR are shown as striped boxes. 25 150 200 300 400 25 Based on the lengths of the exons, you should be able to calculate a rough estimate of the protein encoded by this gene, assuming that all 4 exons are translated and the protein does not undergo any significant processing (cleavage or chemical modifications)....
The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help...
The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help with part C A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3' B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3' C. Determine the DNA coding strand sequence corresponding to the template strand above. Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu...
1.The mRNA for signal peptidase is translated in the ___________. The resulting polypeptide contains__________ as part...
1.The mRNA for signal peptidase is translated in the ___________. The resulting polypeptide contains__________ as part of its primary structure. a. Nucleus, KDEL b. Rough Endoplasmic Reticulum, KDEL c. Nucleolus, KDEL d. Rough Endoplasmic Reticulum, KKKK-----KK e. Nucleolus, KKKK------KK 2. Assume that you have two identical samples of lipids, but that one of them has been made radioactive with C 14 , and the other with H3 . You now coat the surface of one glass slide with the first,...
estion 22 Which of the following elements will be translated by the ribosome? ot yet nswered Select one: O a. Promoter Marked out of 1.00 b. 5 UTR Flag question c. Exons d. Introns
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT involve: A. Excision of non-coding sequences (introns). B. Addition of the 7-methylguanosine cap at the 5'-end. C. Charging of an amino acid residue to the CCA-end. D. Joining of coding sequences (exons). E. Attachment of a long poly(A) sequence at the 3'-end.
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons (shown in solid colors). The 5' UTR and 3' UTR are shown as striped boxes. 25 150 200 300 400 25 Based on the lengths of the exons, you should be able to calculate a rough estimate of the protein encoded by this gene, assuming that all 4 exons are translated and the protein does not undergo any significant processing (cleavage or chemical modifications)....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago