Show the resulting sequences when the sequence is cleaved by the restriction enzyme. Show the complementary...
Show the resulting sequences when the sequence is cleaved by the restriction enzyme. Show the complementary strand as well. i) BamHI 5’ ATCGGGATCCTA 3’ ii) BgIII 5’ GCTCTGCAGATCTA 3’?
Homework Answers
1. The BamH1 recognition sequence is GGATTC so it cleaves the sequence so the following fragments are formed ,
Whereas the BgIII recognition site is AGATCT.
.
Add Answer to:
Show the resulting sequences when the sequence is cleaved by the
restriction enzyme. Show the complementary...
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be...
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be the recognition site on the complementary strand?
The restriction enzyme BamHI cuts the sequence GGATCC, leaving the 5' overhang and a four-base sticky...
The restriction enzyme BamHI cuts the sequence GGATCC, leaving the 5' overhang and a four-base sticky end. Draw the structure of this sequence after it has been cleaved by this enzyme. Abbreviate the nitrogenous bases fully but completely draw the backbone structure of both strands.
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex...
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5"
1. The full-length SNFI...
The partial sequences recognized by two restriction enzymes “A” and “B” are indicated below. Complete the...
The partial sequences recognized by two restriction enzymes “A” and “B” are indicated below. Complete the sequences such that palindromes are generated for each of the sites. On your palindromes indicate which phosphodiester linkage would have to be cleaved such that 5’ protruding ends of enzyme “A” are compatible with protruding ends of enzyme “B”. Ex. CT/GCAG Enzyme “A”: 5’ATAG― ― ― ― 3’ Enzyme “B”: 5’GCG ― ― ― 3’ Consider your answer to the previous question. A DNA...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
1. The full-length SNFI gene was inserted into pLexA at the BamHI restriction site to create pLex-Snfl. To do this, the BamHI recognition sequence was introduced onto both the 5' and 3' ends of the SNFI DNA. Add the necessary nucleotides onto both strands of the DNA represented below: 3 SNF1 sense strand SNF1 antisense strand 5 3' Show the sequence that will result from BamHI digestion: 3 5' SNF1 sense strand SNF1 antisense strand 5"
1. The full-length SNFI...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago