The following DNA sequence contains a bacterial gene:

1. Copy the above sequence and indicate on it the:
a. -10 and -35 promoter region
b. Ribosome binding site
c. Stop codon (and whether it is an amber, opal or ochre codon),
d. Transcriptional terminator.
e. Note the atg start site has been marked and the gene is indicated in italics
2. Is the promoter a strong or weak promoter? Why?
3. Is the terminator a Rho dependent or Rho independent terminator? Why?
Consensus -10 and -35 sequences:
Ribosome binding site (RBS):
Ribosome binding site (RBS) is nucleotide sequence present upstream (2 or 3 to 7 or10 nucleotides upstream) of start codon (AUG) in mRNA. This sequence is important (though not absolute essential) for initiation of translation in prokaryotes (like bacteria).
This sequence, also referred to as Shine-Dalgarno’s (SD) sequence, comprises of 5’ untranslated region (UTR) in mRNA and is purine rich. A complementary pyrimidine rich 3’ sequence (anti-SD sequence) is present in the 16S rRNA of ribosomal subunit. This interaction between the SD sequence of rRNA and anti-SD sequence of mRNA plays an important role (in most cases) for initiation of translation in prokaryotes.

Terminator:
Stop codon:

2.
a)
The promoter is considered strong if they match the ideal consensus sequences, causing maximum interaction with RNA polymerase.or sigma factor.
If the promoter has lesser match with the ideal sequence, the promoter is considered weak.
Thus, the promoter is weak, as -10 and -35 sequences does not match the ideal consensus sequence.
b)
The following DNA sequence contains a bacterial gene: 1. Copy the above sequence and indicate on...
Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA. RBS ribosome binding site UAA translational stop site (UAA) TSS transcriptional start site...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...
Below is the partial coding strand of DNA for a gene containing
an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9,
associated with the following genetic elements. Some elements may
have more than one associated region.
(a) The promoter region
(b) The ribosome binding site
(c) The ribosome binding site consensus
sequence
(d) The start codon
(f) The expected region for the +1
transcription (where the transcript
begins to be made)
(g) Is this a prokaryotic...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
Based on the following picture:
1- Write the DNA sequence of the recombinant pET/GFP plasmid
beginning at the ATG translational start codon and continuing
through the first 4 codons (triplets) of the GFP coding region. Put
a box around the NheI site.1-
2- Also, based on the DNA sequence you have written out above,
write the amino acid sequence of the protein that is encoded by
this DNA. Box the His-tag. Underline the region that corresponds to
the GFP protein...
can you guys please give me the correct answers and explain
why?
19. You clone your favorite E. coli gene including the promoter region, the open reading frame, and some flanking DNA. You determine the DNA sequence of the entire region and map the start site of transcription. You note the following sequence near the end o your gene. What is the likely function of this sequence? ...CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTTTGAAGGTATAT... A. A polyadenylation signal B. A Rut site C. The ribosome binding...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...
A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...