What is the difference between a promoter sequence and a consensus sequence? (In regards to initiating transcription)
Promoter sequence is a sequence of nucleotides on DNA to which RNA polymerase binds to initiate transcription of downstream gene.
Consensus means conserved. A consensus sequence is a highly conserved sequence of nucleotides. With regards to consensus sequence, we can talk about any type of sequence. For example a sequence of promoter, operator, terminator, any type of gene like hemoglobin, myoglobin, any proto-oncogene like RAS and even the sequence of amino acids. Any two proteins or any two genes having similar sequence of amino acids and nucleotide respectively are said to be consensus sequence are conserved sequence.
With respect to promoter sequence which takes part in transcription, we say that the sequence of promoter is highly conserved. We meant to say that the sequence of promoter is almost similar in very unrelated organism. For example the sequence of promoter TATA box is very similar in prokaryotes and eukaryotes, despite being enormous differences between the two types of organisms.
To summarise, a promoter is a consensus sequence but not all consensus sequences are promoter.
Please give a high rating.
What is the difference between a promoter sequence and a consensus sequence? (In regards to initiating...
6. How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? 7. How are mRNAs modified in eukaryotes? What types of elements are sometimes present in RNA's but 8. What is the genetic code? What are the properties of the triplet codons? What does it mean that the code is How and why do consensus sequences differ from one another? usually not in DNA's? redundant and what useful purpose does such redundancy serve?
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in E. coli. The start site for transcription (+1) is the underlined C. TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC 1. The six-base-35 and -10 regions are highlight in the promoter. What is the consensus sequence for these two regions? Indicate how many mismatched bases J23114 has for each. -35 consensus sequence = Number of mismatches: -10 consensus sequence = Number of mismatches: 2. What are the functions of the -35...
Which of the following sequence is the right sequence for a bacterial gene? -35 consensus...transcription start...-10 consensus...coding region...transcription termination transcription start...-35 consensus...coding region...-10 consensus...transcription termination transcription start...-35 consensus...-10 consensus...coding region...transcription termination -35 consensus...-10 consensus...transcription start....coding region...transcription termination
Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single base change in a bacterial gene's-35 TTGACA consensus sequence Complete elimination of the inverted repeat/hairpin loop structure and string • of uracils at the 3' untranslated region of a bacterial gene Complete elimination of the consensus sequence for 3 cleavage of a eukaryotic pre-mRNA Complete elimination of a splice site consensus sequence in a eukaryotic gene Abnormally long mRNA with the possibility of a...
How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A mutation in the -10 (Pribnow) consensus sequence would have what affect?
Consensus sequences that are involved in prokaryotic/bacterial transcription include... A. the -10 consensus sequence or Pribnow box. B. the -35 consensus sequence. C. enahancer sequences. D. Two of the above. E. All of the above.
3. If each sigma factor recognizes a different promoter consensus sequence, how does the cell transcribe a gene that responds to multiple conditions, where each condition utilizes a different sigma factor? What would happen to overall gene expression profiles if RpoS were artificially overexpressed and why?
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
1.What is a consensus sequence, and how is this used to initiate the processes of DNA replication, transcription and translation? 2.Outline several mechanisms by which DNA or RNA (especially mRNA) can be protected from degradation and have “extended life”.
What gene regulation mechanism do eukaryotes share with prokaryotes? OA) Varying the promoter sequence to vary the binding affinity of general transcription factors. OB) Regulating the expression from a single gene with several specific transcription factors. C) Controlling gene expression by restricting access to the promoter. D) Driving the expression of several genes with one promoter. OE) Controlling the expression from a single gene with several general transcription factors.