Question

write the sequence of the GFP and primer DNAs, showing each of the primers annealed to...

write the sequence of the GFP and primer DNAs, showing each of the primers annealed to its complementary sequence in the target (EGFP) DNA. Label the 5’ and 3’ ends of all DNA strands.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

GFP is Green Fluorescent Protein.

F: 5' - CTGGTCGAGCTGGACGGCGACG-3'

R: 5' - CACGAACTCCAGCAGGACCATG -3'

A primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. In living organisms, primers are short strand of RNA. A primer has to be synthesised by an enzyme called primase. the synthesis of a primer is of utmost necessity because DNA polymerase which is an enzyme that synthesises DNA , can only attach a DNA nucleotide to an existing strand of nucleotide. A nucleotide consists of a 5 carbon pentose or rtibose sugar, a nitrogeneous base and a phosphate group.

Add a comment
Know the answer?
Add Answer to:
write the sequence of the GFP and primer DNAs, showing each of the primers annealed to...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...

    To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated...

    Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated to break the hydrogen bonds holding two strands together. b. Primers hybridize to sequences at opposite ends of the target sequence on the same strand.   c. DNA is cooled to allow primers to form hydrogen bonds with the ends of the target sequence. d. The three steps of PCR are denaturation, annealing, and extension. e. PCR produces specific DNA fragments for cloning. f. Taq...

  • CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...

    CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...

  • Which of the following is NOT a reason that each PCR Primer requires a different PCR...

    Which of the following is NOT a reason that each PCR Primer requires a different PCR settings? -because the complimentary strands of the DNA may be composed of more G-C pairs which would require less energy to denature than a strand with more A-T pairs due to the amounts of hydrogen bonds to break in each.         -because the PCR products are different lengths which may require different amounts of time to denature, elongate , and extend the PCR...

  • This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...

    This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...

  • 3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...

    3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...

  • Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...

    Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT