What types of information are encoded by a gene?
A. Contains information to produce a particular protein
B. Contains information to produce a particular RNA
C. Contains information to produce a particular carbohydrate
D. A and B only
E. All of the above
Answer:-
The correct option is (D) i.e A and B only. The reason being is that genes are the segments of the DNA which contains information for the production of essential and important molecules i.e proteins and RNA. Proteins are made up of thousands of amino acids which are being coded by genes in the form of codons ( nucleotide triplet). The information stored in genes for the RNA is used in the process of transcription in which the the genetic information from DNA is transferred to RNA.
Hope the above answer comes up to your expectation. Please do come up with your feedback.
What types of information are encoded by a gene? A. Contains information to produce a particular...
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of protein B changes, what else do we expect to change (please answer yes/no for each)? Transcription of gene A? Splicing of gene A? Rate of translation of RNA copies of gene A? Overall level of protein A in the cell? yes 14. Imagine that a protein regulates a gene. Given that it regulates the other gene at the following levels, circle all that will...
What is the role of the protein
encoded by the lacZ gene?
What is the role of the protein encoded by the lacZ gene? The lacZ gene encodes an enzyme that converts lactose to allolactose, and the lacZ gene O O O O encodes an enzyme that converts lactose to glucose and galactose. The lacZ gene encodes an enzyme that permits lactose to enter the bacterial cell. The lacZ gene encodes an enzyme that converts lactose to glucose and galactose....
What is the BRCA 1 gene, what is the known function of the encoded protein and how can you show it performs this function?
If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT
In a wild-type carnivorous plant, protein X is encoded by a haplosufficient gene “X”. The X protein normally homodimerizes. The X-X dimer enzymatically catalyzes a biochemical reaction that is critical for the digestion of insects that it traps. XD represents a dominant negative allele, a mutation, of gene X. What would be the predicted phenotype of a plant with the genotype X+/XD ? Which one of these pieces of information allows you to reach that conclusion? a. The plant would...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
Sample Question: Which of the following types of gene expression control is unlikely to be used in bacteria? a) Transcriptional control b) Translational control c) RNA processing control d) Protein activity control
.1. Listed below are features of biological molecules. For each, indicate if the feature describes a characteristic of DNA, or RNA, neither DNA nor RNA, or both DNA and RNA. Single stranded Contains hydrogen bonds Is a long molecule Contains covalent bonds Is translated to protein Contains complex carbohydrate Contains thymine Double stranded Is a short molecule Contains uracil Has peptide bonds Contains nucleotides Contains guanine Is confined to the nucleus Makes a replication fork 2. What is a protein? 3. A peptide bond (check "Yes" if correct; "No" if incorrect): Yes Ne A. Joins nucleotides in a...
In a wild-type fungus, protein E (encoded by the haplosufficient gene “E”) normally homodimerizes, and the E-E dimer catalyzes a biochemical reaction necessary for the production of a dark pigment. ED represents a mutant, dominant, negative allele of gene E. What is the predicted phenotype of a fungus cell of genotype E+/ED, and why? A) mutant (no pigment production), as E is haplosufficient B) mutant (no pigment production), as no E-E dimers will form in the heterozygous C) mutant (no...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...